circad | circRNAs associated with diseases

hsa_circ_0005540
Gene	MCTP1	Organism	Human
Genome Locus	chr5:94204037-94248681:-	Build	hg19
Disease	Multiple system atrophy (MSA)	ICD-10	Multiple system atrophy, cerebellar type [MSA-C] (G23.3)
DBLink	Link to database	PMID	27470294
Experimental Method
Sample Type	Brain Tissues	Comparison	6 Frozen Grey Matter (GM) and White Matter (WM) tissue and formalin-fixed paraffinembedded 10-μm-thick tissue sections
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCCAACAAAGGGGGTCATCT Reverse GGGTCTGAAACACAAAAGCA	Statistics	Fold Change : Upregulation,7.819 pvalue : p=0.013
Citation
Chen, BJ, Mills, JD, Takenaka, K, Bliim, N, Halliday, GM, Janitz, M (2016). Characterization of circular RNAs landscape in multiple system atrophy brain. J. Neurochem., 139, 3:485-496.